Coronavirus SARS-CoV2 (covid19) y SARS-CoV3 aparecen en un estudio chino financiado por la Comisión Europea en 2008

Publicado en Journal of Clinical Microbiology (Sociedad Americana para Microbiología)

2008 → Coronavirus SARS-CoV2 (covid19) y SARS-CoV3 aparecen en un estudio chino financiado por la Comisión Europea

 

→ Año 2008 Peking Union Medical College – Hospital. Investigación publicada y co-financiada por la Comisión Europeas sobre CORONAVIRUS: SARS-CoV2 y SARS-CoV3.

¿Por qué dicen que el SARS-CoV2 (covid19) apareció por 1ª vez en 2019?

¿Y que hay del SARS-CoV3? ¿Causará otra pandemia global?

AUTORES DEL ESTUDIO

Yuxiang Wei, Changmei Yang, Baojun Wei, Jie Huang, Lunan Wang, Shuang Meng, Rui Zhang, and Jinming Li

Escuela de Graduados, Peking Union Medical College, Academia China de Ciencias Médicas, Beijing, República Popular de China.

Dirección postal: Departamento de Inmunoensayo y Diagnóstico Molecular

Centro Nacional de Laboratorio Clínico – Beijing Hospital

1 Dahua Road, Dongdan, Beijing 100730, República Popular de China.

E-mail: nc.moc.oohay@nh36mjl

DATOS DEL ESTUDIO

Publicado en Journal of Clinical Microbiology (Sociedad Americana para Microbiología)

Mayo de 2008; 46 (5): 1734-1740.

PMCID: PMC2395109
PMID: 18305135
Publicado en línea el 27 de febrero de 2008

TITULO → *RNase-Resistant Virus-Like Particles Containing Long Chimeric RNA Sequences Produced by Two-Plasmid Coexpression System

“Partículas similares a virus resistentes a la *ARNasa, que contienen secuencias largas de ARN quimérico producidas por el sistema de coexpresión de dos plásmidos”
*RNAse – *ARNasa = una enzima que promueve la descomposición del ARN en oligonucleótidos y moléculas más pequeñas
Descripción del estudio (vía Google Traductor):

Las partículas similares a virus no infecciosas resistentes a la ARNasa que contienen secuencias de ARN exógenas (ARN blindado) son buenas candidatas como controles y estándares de ARN en la detección de virus ARN. Sin embargo, la longitud del ARN empaquetado en las partículas similares a virus con alta eficiencia suele ser inferior a 500 bases. En este estudio, describimos un método para producir L-RNA blindado. El L-ARN blindado es un complejo de proteína de la cubierta del bacteriófago MS2 y ARN producido en Escherichia coli.mediante la inducción de un sistema de coexpresión de dos plásmidos en el que la proteína de la cubierta y la maturasa se expresan a partir de un plásmido y la secuencia de ARN diana con el tallo-bucle de MS2 modificado (sitio pac) se transcribe a partir de otro plásmido.

Un L-RNA blindado 3V de 2248 bases que contiene seis fragmentos de genes: virus de la hepatitis C, coronavirus del síndrome respiratorio agudo severo (SARS-CoV1, SARS-CoV2 y SARS-CoV3), gen de la matriz del virus de la influenza aviar (M300) y H5N1 aviar virus de la influenza (HA300): se expresó con éxito mediante el sistema de coexpresión de dos plásmidos y se demostró que tiene todas las características del ARN blindado.

Evaluamos el L-RNA blindado de 3V como calibrador para múltiples ensayos de virus. Usamos el Estándar Internacional de la OMS para ARN del VHC (NIBSC 96/790) para calibrar el L-ARN blindado quimérico,que se diluyó mediante diluciones seriadas de 10 veces para obtener muestras que contenían 106 a 10 2 copias. En conclusión, el enfoque que utilizamos para la preparación de L-RNA blindado es práctico y podría reducir la mano de obra y el costo del control de calidad en ensayos de virus de ARN multiplex. Además, podemos asignar al ARN blindado quimérico una unidad internacional para la detección cuantitativa.

TABLA 1

Cebadores utilizados para la amplificación por PCR
Nombre de la cartilla
Secuencia del cebador (5 ′ a 3 ′) a
S-MCCG GGATCC TGGCTATCGCTGTAGGTAGCC
A-MCCCC AAGCTT ATGGCCGGCGTCTATTAGTAG
S-SARS1TATCCAAAATGTGACAGAGCCATG
LAP-SARS1ACGCTGAGGTGTGTAGGTGCAGGTAAGCGTAAAACTCATCCAC
A-SARS2TAACCAGTCGGTACAGCTACTAAG
LAP-SARS2AGTTTTACGCTTACCTGCACCTACACACCTCAGCGTTGATATAAAG
A-SARS3ACTACGTGATGAGGAGCGAGAAGAG
LAP-SARS3AGCTGTACCGACTGGTTAACAAATTAAAATGTCTGATAATGGACCCC
LAP-SARS2 +ATCAGACATTTTAATTTGTTAACCAGTCGGTACAGCTACTAAG
S-HCVACATGAGGATCACCCATGT GGCGACACTCCACCATAGATCACTC
HCV-LAP1ATGTAAGACCATTCCGGCTCGCAAGCACCCTATCAGGCAGTAC
A-HA300GAATCCGTCTTCCATCTTTCCCCCACAGTACCAAAAGATCTTC
HA300LAPCTGATAGGGTGCTTGCGAGCCGGAATGGTCTTACATAGTGGAG
M + SLAP1ATGGCTCTGTCACATTTTGGATAGAGTAGCTGAGTGCGACCTCCTTAG
M + SLAP2AAGGAGGTCGCACTCAGCTACTCTATCCAAAATGTGACAGAGCCATG
FIVELAP1CATGGGTGATCCTCATGTACTACGTGATGAGGAGCGAGAAGAG
FIVELAP2CGCTCCTCATCACGTAGTACATGAGGATCACCCATGTGGC
SuperposiciónA ′CC TTAATTAA CCCACAGTACCAAAAGATCTTCTTG
M300-S ′TT GGCCGGCC GAGTCTTCTAACCGAGGTCGAAACG
superposición-ACCCACAGTACCAAAAGATCTTCTTG
M300RT-SGGATTTGTATTCACGCTCACC
HA300RT-ATGGGGATGATCTGAATTTTCTC

 Los sitios de restricción BamHI, HindIII, FseI y PacI, se indican mediante subrayado, a C varianet se indica en negrita

Construcción de pACYC-3V 

Se insertó una secuencia quimérica exógena de 2248 pb de longitud que comprende las siguientes secuencias en un plásmido pACYCDuet-1 (origen de replicación de tipo p15A; Novagen):

      • M-300 (nt 17∼373, 357 pb del gen de la matriz del virus de la influenza aviar; acceso a GenBank nº  DQ864720 ).
      • SARS-CoV1 (nt 15224 a 15618, 395 pb de SARS-CoV; número de registro de GenBank AY864806 )
      • SARS-CoV2 (nt 18038 a 18340, 303 pb de SARS-CoV; número de acceso de GenBank AY864806 )
      • SARS-CoV3 (nt 328110 a 28692, 583 pb de SARS-CoV; número de acceso de GenBank AY864806 ), un sitio pac (19 pb)
      • HCV (nt 18 a 310, 293 pb de HCV 5’UTR; no de acceso de GenBank AF139594 )
      • HA300 (nt 295 a 611, 317 pb del virus de la influenza aviar H5N1; GenBank nº DQ864720 ).

La secuencia diana incluía los sitios del cebador directo e inverso, las regiones flanqueantes y los sitios de unión a la sonda publicados o descritos anteriormente. Se colocó un sitio pac de 19 meros entre el SARS-CoV3 y el VHC (Fig.(Figura 1).1). Empalmamos las seis secuencias de ADN diana utilizando extensiones superpuestas ( 10). Durante la primera ronda de PCR, estos seis pequeños fragmentos se amplificaron como sigue.

El SARS-CoV1 se amplificó a partir de un plásmido pBSSR-V6 (proporcionado amablemente por la Academia China de Ciencias Médicas y el Colegio Médico de la Unión de Pekín, Instituto de Ciencias Médicas Básicas), que contiene nt 13785 a 16051 del gen SARS-CoV, utilizando los cebadores S –SARS1 y LAP-SARS1.

El SARS-CoV2 se amplificó a partir de un plásmido pNCCL-SARS (construido por nuestro laboratorio), que contenía nt 18038 a 18340 del gen SARS-CoV, utilizando los cebadores LAP-SARS2 y A-SARS2.

El SARS-CoV3 se amplificó a partir de un plásmido pBSSR7-8 (proporcionado amablemente por la Academia China de Ciencias Médicas y el Colegio Médico de la Unión de Pekín, Instituto de Ciencias Médicas Básicas), que contiene nt 27730 a 29212 del gen SARS-CoV, utilizando los cebadores LAP -SARS3 y A-SARS3.

……..

En la segunda ronda de PCR, se amplificaron SARS-CoV1 más SARS-CoV2 y HCV más HA300 utilizando los pares de cebadores S-SARS1-LAP-SARS2HA300 se amplificó a partir de un plásmido pNCCL-H5N1 (construido por nuestro laboratorio) utilizando los cebadores HA300LAP y A-HA300. M300 se amplificó a partir de un plásmido pNCCL-H5N1 (construido por nuestro laboratorio) usando los cebadores M300-S ‘y M + SLAP1. Los productos de PCR de la primera ronda de amplificaciones se purificaron en gel y se usaron, junto con los cebadores externos, en la PCR de extensión por superposición. En la segunda ronda de PCR, se amplificaron SARS-CoV1 más SARS-CoV2 y HCV más HA300 utilizando los pares de cebadores S-SARS1-LAP-SARS2HA300 se amplificó a partir de un plásmido pNCCL-H5N1 (construido por nuestro laboratorio) utilizando los cebadores HA300LAP y A-HA300. M300 se amplificó a partir de un plásmido pNCCL-H5N1 (construido por nuestro laboratorio) usando los cebadores M300-S ‘y M + SLAP1.

Los productos de PCR de la primera ronda de amplificaciones se purificaron en gel y se usaron, junto con los cebadores externos, en la PCR de extensión por superposición.

En la segunda ronda de PCR, se amplificaron SARS-CoV1 más SARS-CoV2 y HCV más HA300 utilizando los pares de cebadores S-SARS1-LAP-SARS2 en la extensión de superposición PCR.

En la segunda ronda de PCR, se amplificaron SARS-CoV1 más SARS-CoV2 y HCV más HA300 utilizando los pares de cebadores: S-SARS1-LAP-SARS2+ y FIVELAP2-OverlapA´ respectivamente.

Los productos de PCR de la segunda ronda se purificaron en gel. La PCR de tercera ronda amplificó SARS-CoV1 más SARS-CoV2 más SARS-CoV3 utilizando los cebadores M + SLAP2 y FIVELAP1. Los productos de PCR de la tercera ronda se purificaron en gel.

La PCR de cuarta ronda amplificó SARS-CoV1 más SARS-CoV2 más SARS-CoV3 más HCV más HA300 usando los cebadores M + SLAP2 y OverlapA ′.

La PCR de quinta ronda amplificó M300 más SARS-CoV1 más SARS-CoV2 más SARS-CoV3 más HCV más HA300 utilizando los cebadores M300-S ′ y OverlapA ′. Los cebadores de sentido e inverso contenían sitios de restricción FseI y PacI (subrayados en la TablaTabla 1),1), respectivamente. Los productos de PCR de la quinta ronda se purificaron en gel. Los fragmentos purificados se clonaron en un vector pGEM-T Easy (Promega) y luego se escindieron del plásmido recombinante resultante con las enzimas de restricción FseI y PacI.  ……

Documentación del artículo

Investigación SARS-CoV en China fue financiada por el Proyecto SEPSDA de la  Comisión Europea:

        • Contrato (PDF nº1)
        • Definición y Presupuesto (PDF nº2)
          Definición y Presupuesto  en español (Archivo Imagen)
        • Documentación traducida a español (PDFs  nº 3 y nº 4)

Contrato (PDF nº1)

Definición y Presupuesto (PDF nº2)

Definición y Presupuesto en español (Archivo Imagen)

Datos en español (PDFs  nº 3 y nº 4)

→ Queremos agradecer a la usuaria de Twitter que compartió una imagen de esta Investigación en esa red social. Mila esker Piluca de Sevilla – @PilucaGlezSev – por ponernos tras la pista de esta documentación.

Fuente: https://desmontandoababylon.com/